处理过滤

script/filter_snpindel_common.pl

@@ -0,0 +1,206 @@
+#!/usr/bin/env perl
+use strict;
+#use warnings;
+use List::Util qw(sum);
+
+die "useage:perl $0 input project sample_type somtic_out germline_out tag_out " unless @ARGV == 6;
+my ($input, $project, $sample_type, $somtic_out, $germline_out, $tag_out) = @ARGV;
+
+# die "useage:perl $0 output_dir tumor project sample_type" unless @ARGV == 4;
+# my ($output_dir, $name, $project, $sample_type) = @ARGV;
+
+# open IN, "$output_dir/mutation/${name}.snp.indel.anno.hg19_multianno.txt";
+open IN, "$input";
+my $head = <IN>;
+# if ($sample_type eq 'c') {
+#     open OUT, ">${name}.snp.indel.Somatic.annoall.hg19_multianno_filtered_pre.txt";
+# }
+# elsif ($sample_type eq 't') {
+#     open OUT, ">${name}.snp.indel.Somatic.annoall.hg19_multianno_filtered.txt";
+# }
+
+open OUT, "> $somtic_out";
+print OUT "可信\t$head";
+
+# open OUT2, ">${name}.snp.indel.Germline.anno.hg19_multianno_filtered.txt";
+open OUT2, ">$germline_out";
+print OUT2 "临床意义\t$head";
+
+# open OUT3, ">${name}.snp.indel.anno.hg19_multianno_tag.txt";
+open OUT3, ">$tag_out";
+print OUT3 "TAG\t$head";
+
+##black list
+my $public_path = defined $ENV{'PUBLIC'} ? $ENV{'PUBLIC'} : "/dataseq/jmdna/codes/public/";
+open BKLT, "$public_path/blacklist.txt";
+my %bk;
+<BKLS>;
+while (<BKLT>) {
+    chomp;
+    my @line = split("\t");
+    my $key = join("_", @line[0 .. 4]);
+    $bk{$key} = 1;
+}
+sub blacklist {
+    my $pos = shift @_;
+    if (exists $bk{$pos}) {
+        return "1";
+    }
+    else {
+        return "";
+    }
+}
+
+open INFO, "$public_path/info.txt";
+my @muts;
+while (<INFO>) {
+    chomp;
+    my @line = split(/\t/, $_);
+    if ($line[0] eq $project) {
+        if ($line[2] ne "NA") {
+            @muts = split(/\//, $line[2]);
+        }
+    }
+}
+while (<IN>) {
+    chomp;
+    my @line = split(/\t/, $_);
+    my $freq = (split(":", $line[-1]))[4];
+    #	next if $line[9] eq '.';
+    if ($line[8] ne "synonymous SNV" and $line[8] ne "unknown"){
+		if ( $line[17] < 0.01 and $line[18] < 0.01 and $line[19] < 0.01 and $line[20] < 0.01 and $line[23] < 0.01 and $line[28] < 0.01 and $line[32] < 0.01){
+			if ($line[16] =~ /benign/i and $line[16] !~ /pathogenic|Affects|association|Conflicting|sensitivity|drug|other|risk|protective|Uncertain|not_provided|\./i) {
+				print OUT3 "benign\t", join("\t", @line), "\n";
+				next;
+			}
+			if ($sample_type eq 'c') {
+				if ($line[11] =~ /OCCURENCE=(\S+)/) {
+					my $cosmic = $1;
+					$cosmic =~ s/\(\S+?\)//g;
+					my @cosmic = split(",", $cosmic);
+					$cosmic = sum @cosmic;
+					if ($freq < 0.01 and $cosmic <= 1) {
+						print OUT3 "cfdna_lowfreq_cosmic\t", join("\t", @line), "\n";
+						next;
+					}
+				}
+				if ($freq < 0.01 and $line[11] eq '.') {
+					print OUT3 "cfdna_lowfreq_cosmic\t", join("\t", @line), "\n";
+					next;
+				}
+			}
+			#blacklist
+			my $key = join("_", @line[0 .. 4]);
+			if (&blacklist($key)) {
+				print OUT3 "blacklist\t", join("\t", @line), "\n";
+				next;
+			};
+			if ($line[9] ne '.') {
+				my @hgvs = split(/,/, $line[9]);
+				my $hgvs = $hgvs[0];
+				$hgvs =~ /(\S+):(\S+):exon(\d+):c\.(\S+):p\.(\S+)$/;
+				my $gene = $1;
+				if (!(@muts and grep {$gene eq $_} @muts)) {
+					print OUT3 "nontarget_gene\t", join("\t", @line), "\n";
+					next;
+				}
+
+				if ($line[101] ne 'PASS') {
+					my $filter = split(";", $line[101]);
+					if ($freq < 0.02 or ($freq >= 0.02 and $freq < 0.05 and $filter >= 2)) {
+						print OUT3 "byfilter\t", join("\t", @line), "\n";
+						next;
+					};
+				}
+				if (my $transcript = &transcript($gene)) {
+					if (grep {/$transcript/} @hgvs) {
+						$hgvs = (grep {/$transcript/} @hgvs)[0];
+					}
+				}
+				$line[9] = $hgvs;
+				print OUT "1\t", join("\t", (@line[0 .. 4], "exonic", $gene, @line[7 .. $#line])), "\n";
+				print OUT3 "PASS\t", join("\t", @line), "\n";
+				if ($freq > 0.1) {
+					if ($line[16] =~ /Likely_pathogenic|drug/i) {
+						print OUT2 "2\t", join("\t", (@line[0 .. 4], "exonic", $gene, @line[7 .. $#line])), "\n";
+					}
+					elsif ($line[16] =~ /pathogenic/i and $line[16] !~ /Conflicting/i) {
+						print OUT2 "1\t", join("\t", (@line[0 .. 4], "exonic", $gene, @line[7 .. $#line])), "\n";
+					}
+					else {
+						print OUT2 "3\t", join("\t", (@line[0 .. 4], "exonic", $gene, @line[7 .. $#line])), "\n";
+					}
+				}
+			}
+			elsif ($line[5] =~ /splicing/) {
+				next if $line[101] ne 'PASS';
+				my $gene = (split(";", $line[6]))[0];
+				if (!(@muts and grep {$gene eq $_} @muts)) {
+					print OUT3 "nontarget_gene\t", join("\t", @line), "\n";
+					next;
+				};
+				my @hgvs = split(/;/, $line[7]);
+				my $hgvs = $hgvs[0];
+				if (my $transcript = &transcript($gene)) {
+					if (grep {/$transcript/} @hgvs) {
+						$hgvs = (grep {/$transcript/} @hgvs)[0];
+					}
+				}
+				$hgvs =~ /(\S+):exon(\d+):c\.(\S+)$/;
+				my $spl = $3;
+
+				if ($spl =~ /\d+[\+|\-][1|2]\D+/) {
+					$line[7] = join(":", ($gene, $hgvs));
+					print OUT3 "PASS\t", join("\t", @line), "\n";
+					print OUT "1\t", join("\t", (@line[0 .. 4], "splicing", $gene, '.', '.', @line[7, 10 .. $#line])), "\n";
+					if ($freq > 0.1) {
+						if ($line[16] =~ /Likely_pathogenic|drug/i) {
+							print OUT2 "2\t", join("\t", (@line[0 .. 4], "splicing", $gene, '.', '.', @line[7, 10 .. $#line])), "\n";
+						}
+						elsif ($line[16] =~ /pathogenic/i and $line[16] !~ /Conflicting/i) {
+							print OUT2 "1\t", join("\t", (@line[0 .. 4], "splicing", $gene, '.', '.', @line[7, 10 .. $#line])), "\n";
+						}
+						else {
+							print OUT2 "3\t", join("\t", (@line[0 .. 4], "splicing", $gene, '.', '.', @line[7, 10 .. $#line])), "\n";
+						}
+					}
+				}
+				else {
+					print OUT3 "unknow1\t", join("\t", @line), "\n";
+				}
+
+			}
+			else {
+				print OUT3 "unknow2\t", join("\t", @line), "\n";
+			}
+		}
+		else{
+			print OUT3 "common_snp\t", join("\t", @line), "\n";
+		}
+    }
+    else {
+        print OUT3 "synonymous\t", join("\t", @line), "\n";
+    }
+}
+
+
+
+sub transcript {
+    my $gene = shift @_;
+    my $data_path = defined $ENV{'DATABASE'} ? $ENV{'DATABASE'} : "/dataseq/jmdna/codes/reportbase/";
+    open TR, "$data_path/oncokbgene.txt";
+    my %oncogene;
+    while (<TR>) {
+        chomp;
+        my @line = split;
+        $oncogene{$line[0]} = $line[2];
+    }
+    if (exists $oncogene{$gene}) {
+        $oncogene{$gene} =~ s/\.\d+//;
+        return $oncogene{$gene};
+    }
+    else {
+        print "$gene has no NM id in oncokbgene.txt";
+        return "";
+    }
+}	

script/filter_snpindel_umi_1r_plus_2r.pl

@@ -0,0 +1,45 @@
+#!/usr/bin/env perl
+use strict;
+use warnings;
+
+die "usage:perl $0 vcf1r vcf2r outvcf" unless @ARGV == 3;
+my ($vcf1r, $vcf2r, $outvcf) = @ARGV;
+
+# open R1, "${outputdir}/mutation/${tumor}.1r.snp.indel.vcf";
+# open R2, "${outputdir}/mutation/${tumor}.2r.snp.indel.vcf";
+# open OUT, ">${outputdir}/mutation/${tumor}.snp.indel.vcf";
+
+open R1, "$vcf1r";
+open R2, "$vcf2r";
+open OUT, ">$outvcf";
+
+my (%r1, %r2);
+while (<R2>) {
+    next if /^#/;
+    chomp;
+    my @line = split;
+    my $key = join("_", @line[0, 1, 3, 4]);
+    $r2{$key} = $_;
+}
+
+while (<R1>) {
+    if (/^#/) {
+        print OUT;
+        next;
+    }
+    chomp;
+    my @line = split;
+    my $freq = (split(":", $line[-1]))[4];
+    my $dp = (split(":", $line[-1]))[1];
+    next if $dp < 50;
+
+    if ($freq < 0.01) {
+        my $key = join("_", @line[0, 1, 3, 4]);
+        if (exists $r2{$key}) {
+            print OUT "$_\n";
+        }
+    }
+    else {
+        print OUT "$_\n";
+    }
+}

script/filter_snpindel_umi_correct_f1r1.py

@@ -0,0 +1,115 @@
+#!/usr/bin/python3
+# -*- coding: UTF-8 -*-
+import sys
+
+import pandas as pd
+import pysam
+
+if len(sys.argv) != 4:
+    print(" ".join(['usage:python', sys.argv[0], 'filter_file', 'bam_file', 'output']))
+    sys.exit()
+
+# output_dir = sys.argv[1]
+# tumor = sys.argv[2]
+
+# infile = "".join([output_dir, '/mutation/', tumor, '.snp.indel.Somatic.annoall.hg19_multianno_filtered_pre.txt'])
+# bamfile = "".join([output_dir, '/alignment/', tumor, '.rmdup.bam'])
+# outfile = "".join([output_dir, '/mutation/', tumor, '.snp.indel.Somatic.annoall.hg19_multianno_filtered.txt'])
+
+infile = sys.argv[1]
+bamfile = sys.argv[2]
+outfile = sys.argv[3]
+
+samfile = pysam.AlignmentFile(bamfile)
+
+OUT = open(outfile, 'w')
+
+
+def correct(chr, start, end, alt_base):
+    total_reads = []
+    alt_reads = []
+    for pileupcolumn in samfile.pileup(chr, start, end, stepper="samtools", min_base_quality=0, min_mapping_quality=20,
+                                       max_depth=100000, ignore_overlaps=False, truncate=True, ignore_orphans=False):
+        for pileupread in pileupcolumn.pileups:
+            # print(str(pileupread))
+            if not pileupread.is_del and not pileupread.is_refskip:
+                if pileupread.alignment.query_sequence[pileupread.query_position] == alt_base:
+                    alt_reads.append(pileupread.alignment.query_name)
+                else:
+                    if pileupread.alignment.get_tag('NM') < 4 and pileupread.alignment.query_qualities[
+                        pileupread.query_position] >= 20:
+                        total_reads.append(pileupread.alignment.query_name)
+    alt_reads = list(set(alt_reads))
+    non_alt_depth = len(list(set(total_reads)))
+    dic = {'chr': [],
+           'pos': [],
+           'read': [],
+           'base': [],
+           'quality': [],
+           'NM': [],
+           'FR_RR': []
+           }
+    for read in alt_reads:
+        for pileupcolumn in samfile.pileup(chr, start, end, stepper="samtools", min_base_quality=0,
+                                           min_mapping_quality=20, max_depth=100000, ignore_overlaps=False,
+                                           truncate=True, ignore_orphans=False):
+            for pileupread in pileupcolumn.pileups:
+                if not pileupread.is_del and not pileupread.is_refskip and pileupread.alignment.query_name == read:
+                    dic['chr'].append(pileupcolumn.reference_name)
+                    dic['pos'].append(pileupcolumn.reference_pos + 1)
+                    dic['read'].append(pileupread.alignment.query_name)
+                    dic['base'].append(pileupread.alignment.query_sequence[pileupread.query_position])
+                    dic['quality'].append(pileupread.alignment.query_qualities[pileupread.query_position])
+                    dic['NM'].append(pileupread.alignment.get_tag('NM'))
+                    fr = 0
+                    rr = 0
+                    if pileupread.alignment.has_tag('FR'):
+                        fr = pileupread.alignment.get_tag('FR')
+                    if pileupread.alignment.has_tag('RR'):
+                        fr = pileupread.alignment.get_tag('RR')
+                    dic['FR_RR'].append(fr + rr)
+    dic = pd.DataFrame(dic)
+    b = alt_reads[:]
+    for R in b:
+        if len(list(dic[dic['read'] == R]['base'])) == 2:
+            if list(dic[dic['read'] == R]['base'])[0] != list(dic[dic['read'] == R]['base'])[1]:
+                print(dic[dic['read'] == R]['base'])
+                print(dic[dic['read'] == R]['quality'])
+                alt_reads.remove(R)
+            else:
+                if (list(dic[dic['read'] == R]['quality'])[0] >= 20 and list(dic[dic['read'] == R]['NM'])[0] < 4) or (
+                        list(dic[dic['read'] == R]['quality'])[1] >= 20 and list(dic[dic['read'] == R]['NM'])[1] < 4):
+                    pass
+                else:
+                    alt_reads.remove(R)
+        else:
+            if list(dic[dic['read'] == R]['quality'])[0] < 20 or list(dic[dic['read'] == R]['NM'])[0] >= 4:
+                alt_reads.remove(R)
+    alt_reads_num = len(alt_reads)
+    total_depth = non_alt_depth + alt_reads_num
+    correct_num = 0
+    for index, row in dic.iterrows():
+        if row['read'] in alt_reads:
+            if row['quality'] >= 20 and row['NM'] < 4 and row['FR_RR'] > 1:
+                correct_num += 1
+    #  if alt_reads_num > 3 and correct_num > 0:
+    #    return(alt_reads_num)
+    #  else:
+    #    return(0)
+    return (alt_reads_num, correct_num, total_depth)
+
+
+snv = pd.read_table(infile, sep="\t")
+cols = [index for index, row in snv[snv['可信'] == 0].iterrows()]
+snv.drop(cols, inplace=True)
+drop_index = []
+for index, row in snv.iterrows():
+    if len(row['Ref']) == 1 and len(row['Alt']) == 1:
+        if float(row['Otherinfo13'].split(':')[4]) < 0.05:
+            c = correct(row['Chr'], row['Start'] - 1, row['End'], row['Alt'])
+            if float(c[0]) < 3 or float(c[1]) < 1 or float(c[0] / (c[0] + c[2])) < 0.002:
+                drop_index.append(index)
+
+snv.drop(labels=drop_index, inplace=True)
+# OUT.write(snv)
+snv.to_csv(outfile, index=False, sep="\t")

script/filter_snpindel_umi_subnormal.pl

@@ -0,0 +1,46 @@
+#!/usr/bin/env perl
+use strict;
+use warnings;
+
+die "usage:perl $0 tumor normal output" unless @ARGV == 3;
+my ($tumor, $normal, $output) = @ARGV;
+open T, "$tumor";
+open N, "$normal";
+open OUT, "> $output";
+
+my %n;
+while (<N>) {
+    next if /^#/;
+    chomp;
+    my @line = split;
+    my $freq = (split(":", $line[-1]))[4];
+    my $key = join '_', @line[0, 1, 3, 4];
+    $n{$key} = $freq;
+}
+
+while (<T>) {
+    if (/^#/) {
+        print OUT;
+        next;
+    }
+    chomp;
+    my @line = split;
+    my $freq = (split(":", $line[-1]))[4];
+    my $key = join '_', @line[0, 1, 3, 4];
+    if (not exists $n{$key}) {
+        print OUT "$_\n";
+        next;
+    }
+    else {
+        # 去除对照样本中频率大于0.05的
+        if ($n{$key} >= 0.05) {
+            next;
+        }
+        else {
+            # 频率是对照样本的五倍？
+            if ($freq / $n{$key} > 5) {
+                print OUT "$_\n";
+            }
+        }
+    }
+}

script/func_fetch_bam.py

@@ -0,0 +1,29 @@
+#!/usr/bin/env python3
+# -*- coding: UTF-8 -*-
+import sys
+
+import pysam
+
+# 提取fr+rr>=2的点
+if len(sys.argv) != 3:
+    print(" ".join(['usage:python', sys.argv[0], 'outputDir', 'tumor']))
+    sys.exit()
+
+# output_dir = sys.argv[1]
+# tumor = sys.argv[2]
+
+# infile = "".join([output_dir, '/alignment/', tumor, '.rmdup.bam'])
+# outfile = "".join([output_dir, '/alignment/', tumor, '.2r.rmdup.bam'])
+samfile = pysam.AlignmentFile(sys.argv[1], "rb")
+bamfile = pysam.AlignmentFile(sys.argv[2], "wb", template=samfile)
+for s in samfile:
+    fr = 0
+    rr = 0
+    if s.has_tag('FR'):
+        fr = s.get_tag('FR')
+    if s.has_tag('RR'):
+        rr = s.get_tag('RR')
+    if fr + rr >= 2:
+        bamfile.write(s)
+
+# os.system('samtools index ' + outfile)

script/public/blacklist.txt

@@ -0,0 +1,21 @@
+Chr	Start	End	Ref	Alt	Gene	AAchange
+chr6	29911227	29911228	GA	TG	HLA-A	p.E176W
+chr6	29912029	29912030	GG	C	HLA-A	p.Q250Hfs*47
+chr6	29912383	29912383	G	A	HLA-A	p.R334R
+chr6	31237764	31237774	TCATAGCGGTG	CCACAACAGCC	HLA-C	p.T329_M332delinsAVVV
+chr6	31237994	31237994	C	-	HLA-C	p.S297Afs*25
+chr6	31238865	31238865	T	-	HLA-C	p.T202Rfs*12
+chr6	31238884	31238884	G	T	HLA-C	p.Y195X
+chr6	31238909	31238910	GT	AG	HLA-C	p.T187L
+chr6	31239431	31239431	C	-	HLA-C	p.A97Lfs*4
+chr6	31239490	31239490	C	-	HLA-C	p.E77Sfs*24
+chr6	31324003	31324004	TC	GT	HLA-B	p.E187T
+chr6	31324525	31324536	CCTGGGCCTTGT	TGTTGGTCTTGG	HLA-B	p.Y91_A95delinsSKTNT
+chr6	31324734	31324861	CCTGGGGGTGAGGAGGGGCTGAGACCCGCCCGACCCTCCTCCCGGCGCGGCTCCTCAGGTCCTGCGCCCCCGCCTGCGGTCCCCTCGCTCCTCCCGGCAGAGGCCATTTCCCTCCCGACCCGCACTCA	-	HLA-B	p.G25Afs*5
+chr6	29910581	29910583	CGC	AGT	HLA-A	p.R41S
+chr6	31237862	31237862	T	A	HLA-C	p.E299V
+chr6	31324525	31324549	CCTGGGCCTTGTAGATCTGTGTGTT	TCTGGCGCTTGTACTTCTGTGTCTC	HLA-B	p.N87_A95delinsETQKYKRQT
+chr6	31238909	31238910	GT	TC	HLA-C	p.T187E
+chr3	10088407	10088410	AGTA	-	FANCD2	p.V427Ffs*20
+chr12	57112003	57112003	A	G	NACA	p.M1104T
+chr12	57112022	57112022	A	G	NACA	p.S1098P

script/public/info.txt

@@ -0,0 +1,6 @@
+project	probe	mutation	splicing	promoter	cnv	fusion	long_indel	chemotherapy_drug	non_target_mutation
+160gene	/dataseq/jmdna/database/bed/160.bed	AKT1/ALK/APC/ATM/BARD1/BRAF/BRCA1/BRCA2/BRIP1/CCND1/CCND2/CCND3/CDK12/CDK4/CDK6/CDKN2A/CHEK1/CHEK2/CSF1R/CTNNB1/DDR2/EGFR/ERBB2/ERBB3/ERBB4/FANCL/FBXW7/FGFR1/FGFR2/FGFR3/FLT3/GNA11/GNAQ/HRAS/IDH1/IDH2/JAK1/JAK2/JAK3/KDR/KIT/KRAS/MAP2K1/MET/MTOR/NF1/NRAS/NTRK1/NTRK2/NTRK3/PALB2/PDGFRA/PDGFRB/PIK3CA/PTEN/RAD51B/RAD51C/RAD51D/RAD54L/RB1/RET/ROS1/SMAD4/SMO/STK11/TP53/TSC1/TSC2/VHL	MET	TERT	CDK4/EGFR/ERBB2/FGFR1/FGFR2/FGFR3/FLT3/MET/MDM2/MDM4/CDKN2A	ALK/NTRK1/NTRK2/NTRK3/RET/ROS1	BCL2L11	NA	NA
+650gene	/dataseq/jmdna/database/bed/650.bed	ABL1/AKT1/AKT2/AKT3/ALK/APC/ARAF/ATM/BARD1/BRAF/BRCA1/BRCA2/BRIP1/BTK/CCND1/CCND2/CCND3/CDK12/CDK4/CDK6/CDKN2A/CDKN2B/CHEK1/CHEK2/CSF1R/CTNNB1/DDR2/EGFR/ERBB2/ERBB3/ERBB4/ESR1/EZH2/FANCL/FBXW7/FGFR1/FGFR2/FGFR3/FGFR4/FLT3/GNA11/GNAQ/HRAS/IDH1/IDH2/JAK1/JAK2/JAK3/KDR/KIT/KRAS/MAP2K1/MAP2K2/MET/MPL/MTOR/MYCN/MYD88/NF1/NF2/NRAS/NTRK1/NTRK2/NTRK3/PALB2/PDGFRA/PDGFRB/PIK3CA/PTCH1/PTEN/RAD51B/RAD51C/RAD51D/RAD54L/RAF1/RB1/RET/ROS1/SMAD4/SMARCB1/SMO/STK11/TP53/TSC1/TSC2/VHL	MET	TERT	CDK4/EGFR/ERBB2/FGFR1/FGFR2/FGFR3/FLT3/MET/MYCN/MDM2/MDM4/CDKN2A/CDKN2B	ALK/BRAF/FGFR1/FGFR2/FGFR3/NTRK1/NTRK2/NTRK3/RET/ROS1	BCL2L11 NA	NA
+lung85gene	/dataseq/jmdna/database/bed/160.bed	AKT1/ALK/ATM/BARD1/BCL2L11/BRAF/BRCA1/BRCA2/BRIP1/CCND1/CCND2/CDK12/CDK4/CDKN2A/CHEK1/CHEK2/CSF1R/DDR2/EGFR/ERBB2/ERBB4/FANCL/FBXW7/FGFR1/FGFR2/FGFR3/HRAS/IDH1/KIT/KRAS/MET/MTOR/MYC/NF1/NRAS/NTRK1/NTRK2/NTRK3/PALB2/PDGFRA/PIK3CA/PTEN/RAD51B/RAD51C/RAD51D/RAD54L/RET/ROS1/TP53/TSC1/TSC2/VHL/STK11/APC/ARID1A/CTNNB1/EPCAM/ERBB3/MAP2K1/MLH1/MSH2/MSH6/PMS2/RB1/SMAD4/SMO	MET	NA	ALK/CCND1/CCND2/CDK4/CDKN2A/CSF1R/EGFR/ERBB2/FGFR1/FGFR2/FGFR3/MET/MYC/SMO	ALK/NTRK1/NTRK2/NTRK3/RET/ROS1	BCL2L11	ABCB1/CASP7/CDA/CYP2C8/CYP3A4/DPYD/DYNC2H1/ERCC1/ERCC2/GSTP1/MTHFR/NQO1/SOD2/TPMT/TYMS/UGT1A1/XRCC1/XPC/HAS3
+crc88gene	/dataseq/jmdna/database/bed/160.bed	AKT1/ALK/APC/ARID1A/ATM/BARD1/BRAF/BRCA1/BRCA2/BRIP1/CCND2/CCND3/CDK12/CDK4/CDKN2A/CHEK1/CHEK2/CSF1R/CTNNB1/EGFR/EPCAM/ERBB2/FANCL/FBXW7/FGFR1/FGFR2/FGFR3/FLT3/IDH1/KDR/KIT/KRAS/MAP2K1/MET/MLH1/MSH2/MSH6/MTOR/NF1/NRAS/NTRK1/NTRK2/NTRK3/PALB2/PDGFRA/PIK3CA/PMS2/PTEN/RAD51B/RAD51C/RAD51D/RAD54L/RB1/RET/ROS1/SMAD4/SMO/TP53/TSC1/TSC2/VHL/POLD1/POLE/STK11/MUTYH/SDHA/SDHB/SDHC/SDHD	MET	NA	ALK/CCND2/CCND3/CDK4/CDKN2A/CSF1R/EGFR/ERBB2/FGFR1/FGFR2/FGFR3/FLT3/MET/PTEN/RB1	ALK/NTRK1/NTRK2/NTRK3/RET/ROS1	NA	ABCB1/CASP7/CDA/CYP2C8/CYP3A4/DPYD/DYNC2H1/ERCC1/ERCC2/GSTP1/MTHFR/NQO1/SOD2/TPMT/TYMS/UGT1A1/XRCC1/XPC/HAS3	NA
+17gene	/dataseq/jmdna/database/bed/lung17gene.hg19.liftover.bed	EGFR/BRAF/ERBB2/ALK/MET/AKT1/KRAS/MAP2K1/NRAS/PTEN/PIK3CA/NTRK1/NTRK2/NTRK3	MET	NA	ERBB2/MET/EGFR	ALK/RET/ROS1/NTRK1/NTRK2/NTRK3	BCL2L11	NA	lung

script/run_pipeline.py

@@ -0,0 +1,33 @@
+import argparse
+import os
+
+run_wdl_path = os.path.join(os.path.dirname(__file__), 'run_wdl.py')
+
+if __name__ == '__main__':
+    parser = argparse.ArgumentParser(description="JM to run pipeline")
+
+    parser.add_argument('-n', '--barcode', help="sample's barcode", required=True)
+    parser.add_argument('-s', '--normal', help="sample's normal", default='', required=False, nargs='?')
+    parser.add_argument('-u', '--umi', action='store_true', help="is umi sample", default=False)
+    parser.add_argument('-i', '--input_dir', help="sample's input_dir/workdir", required=True)
+    parser.add_argument('-o', '--output_dir', help="Output directory, default ./", default='./')
+    parser.add_argument('-p', '--project', help="project", required=True)
+    parser.add_argument('-b', '--bed', help="bed", required=True)
+    parser.add_argument('-w', '--wdl', help="wdl")
+
+    args = parser.parse_args()
+
+    res_path = os.path.realpath(os.path.join(args.output_dir, args.barcode))
+
+    if not os.path.exists(res_path):
+        os.mkdir(res_path)
+
+    cmd = f'nohup python ' \
+          f'{run_wdl_path} -n {args.barcode} -s {args.normal} ' \
+          f'{"-u " if args.umi else ""} -i {args.input_dir} ' \
+          f'-o {res_path} -b {args.bed} -p {args.project} -w {args.wdl} ' \
+          f'> {res_path}/{args.barcode}_run.log ' \
+          f'2>> {res_path}/{args.barcode}_run.log &'
+    with open(os.path.join(res_path, 'exec'), 'w') as execfile:
+        execfile.write(cmd + '\n')
+    os.system(cmd)

script/run_wdl.py

@@ -0,0 +1,70 @@
+import argparse
+import json
+import os
+import subprocess
+import time
+
+
+def run(barcode, normal, umi, input_dir, output_dir, project, bed, wdl):
+    input_dir = os.path.realpath(input_dir)
+    output_dir = os.path.realpath(output_dir)
+    wdl = os.path.realpath(wdl)
+    arg = {
+        "pipeline.tumor": barcode,
+        "pipeline.normal": normal,
+        "pipeline.umi": umi,
+        "pipeline.input_dir": input_dir,
+        "pipeline.output_dir": output_dir,
+        "pipeline.project": project,
+        "pipeline.bed": bed
+    }
+
+    arg = {key: value for key, value in arg.items() if value not in (None, '', False)}
+
+    # generate json
+    jsfile_path = os.path.join(output_dir, f'{barcode}.json')
+    with open(jsfile_path, 'w') as jsfile:
+        jsfile.write(json.dumps(arg, indent=4, ensure_ascii=False))
+
+    # run pipeline
+    cmd1 = 'export PATH=/home/zhangchao/project/pipeline/workflow/script:$PATH'
+    cmd2 = 'export PUBLIC=/home/zhangchao/project/pipeline/workflow/script/public/'
+    cmd3 = f'cd {output_dir}'
+    cmd4 = f'/home/zhangchao/soft/jdk-17.0.7+7/bin/java -jar /home/zhangchao/soft/cromwell-85.jar run --inputs {jsfile_path} {wdl}'
+    cmd = f'{cmd1}; {cmd2}; {cmd3}; {cmd4}'
+
+    # 记录开始时间
+    start_time = time.time()
+    print(cmd)
+    ret = subprocess.Popen(cmd, shell=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE, encoding="utf-8")
+    pidnum = ret.pid
+    with open(os.path.join(output_dir, 'pid'), 'w') as pidfile:
+        pidfile.write(str(pidnum))
+    ret.wait()
+    # 记录结束时间
+    end_time = time.time()
+    # 计算运行时间
+    elapsed_time = end_time - start_time
+
+    print("\n运行时间：{:.2f} 秒".format(elapsed_time))
+
+    print(ret.stdout.read(), ret.stderr.read())
+    print('#' * 50)
+    print('读取日志')
+
+
+if __name__ == '__main__':
+    parser = argparse.ArgumentParser(description="JM to run pipeline")
+
+    parser.add_argument('-n', '--barcode', help="sample's barcode", required=True)
+    parser.add_argument('-s', '--normal', help="sample's normal", default='', required=False, nargs='?')
+    parser.add_argument('-u', '--umi', action='store_true', help="is umi sample", default=False)
+    parser.add_argument('-i', '--input_dir', help="sample's input_dir/workdir", required=True)
+    parser.add_argument('-o', '--output_dir', help="Output directory, default ./", default='./')
+    parser.add_argument('-p', '--project', help="project", required=True)
+    parser.add_argument('-b', '--bed', help="bed", required=True)
+    parser.add_argument('-w', '--wdl', help="wdl")
+
+    args = parser.parse_args()
+
+    run(args.barcode, args.normal, args.umi, args.input_dir, args.output_dir, args.project, args.bed, args.wdl)

wdl/call_mutation.wdl

@@ -10,7 +10,6 @@ task mutation_calling_umi {
         mkdir ${output_dir}/mutation
         fi
 
-
         #1条call
         # 这个情况是reads数目只有1，但是如果去掉了这个reads数导致数据量减少很多
         # -r 3 是指有3条这样样的reads支撑
@@ -27,7 +26,7 @@ task mutation_calling_umi {
         -N ${name} -E -f 0.001 > ${output_dir}/mutation/${name}.1r.snp.indel.vcf
 
         #提取>=2条矫正的序列
-        python3 /home/zhangchao/project/pipeline/control/script/fetch_bam.py ${output_dir}/alignment/${name}.rmdup.bam ${output_dir}/alignment/${name}.2r.rmdup.bam
+        func_fetch_bam.py ${output_dir}/alignment/${name}.rmdup.bam ${output_dir}/alignment/${name}.2r.rmdup.bam
         samtools index ${output_dir}/alignment/${name}.2r.rmdup.bam
 
         # 保证 1r call mut umi family 里面有2条reads
@@ -38,25 +37,15 @@ task mutation_calling_umi {
         | /dataseq/jmdna/software/VarDict-1.8.3/bin/var2vcf_valid.pl -N ${name} -E -f 0.001 >${output_dir}/mutation/${name}.2r.snp.indel.vcf
 
         #merge突变，以1条方式call的>0.01的突变+两条方式的对一条方式的低频区域（AF<0.01）进行矫正。
-        perl  /home/zhangchao/project/pipeline/control/script/1r_plus_2r.pl \
+        filter_snpindel_umi_1r_plus_2r.pl \
         ${output_dir}/mutation/${name}.1r.snp.indel.vcf \
         ${output_dir}/mutation/${name}.2r.snp.indel.vcf \
         ${output_dir}/mutation/${name}.snp.indel.vcf
 
-        table_annovar.pl \
-        ${output_dir}/mutation/${name}.snp.indel.vcf \
-        /dataseq/jmdna/software/annovar/humandb/ \
-        -buildver hg19 -nastring . -vcfinput -remove -otherinfo \
-        -protocol refGene,avsnp150,cosmic91,clinvar_20220320,1000g2015aug_all,1000g2015aug_eas,esp6500siv2_all,exac03nontcga,gnomad_genome,dbnsfp35c,cytoBand \
-        -argument '-splicing_threshold 2 -hgvs',,,,,,,,,, \
-        --intronhgvs 50 \
-        -operation g,f,f,f,f,f,f,f,f,f,r \
-        --outfile ${output_dir}/mutation/${name}.snp.indel.anno
-
     >>>
 
     output {
-        String vcf = "${output_dir}/mutation/${name}.filter.flag.snp.indel.vcf"
+        String vcf = "${output_dir}/mutation/${name}.snp.indel.vcf"
     }
 }
 
@@ -86,16 +75,6 @@ task mutation_calling_tissue {
         -c 1 -S 2 -E 3 -g 4 ${bed} |/dataseq/jmdna/software/VarDict-1.8.3/bin/teststrandbias.R \
         |/dataseq/jmdna/software/VarDict-1.8.3/bin/var2vcf_valid.pl -N ${name} -E -f 0.01 >${output_dir}/mutation/${name}.snp.indel.vcf
 
-        table_annovar.pl \
-        ${output_dir}/mutation/${name}.snp.indel.vcf \
-        /dataseq/jmdna/software/annovar/humandb/ \
-        -buildver hg19 -nastring . -vcfinput -remove -otherinfo \
-        -protocol refGene,avsnp150,cosmic91,clinvar_20220320,1000g2015aug_all,1000g2015aug_eas,esp6500siv2_all,exac03nontcga,gnomad_genome,dbnsfp35c \
-        -argument '-splicing_threshold 2 -hgvs',,,,,,,,, \
-        -operation g,f,f,f,f,f,f,f,f,f \
-        --intronhgvs 50 \
-        --outfile ${output_dir}/mutation/${name}.snp.indel.anno
-
     >>>
 
     output {
@@ -124,15 +103,73 @@ task mutation_calling_tissue_control {
         -UN -Q 20 -m 3 -r 3 -th 20 -c 1 -S 2 -E 3 -g 4 ${bed} | /dataseq/jmdna/software/VarDict-1.8.3/bin/testsomatic.R \
         | /dataseq/jmdna/software/VarDict-1.8.3/bin/var2vcf_paired.pl -N ${name} -f 0.01 > ${output_dir}/mutation/${name}.snp.indel.vcf
 
-        table_annovar.pl \
+    >>>
-        ${output_dir}/mutation/${name}.snp.indel.vcf \
+
-        /dataseq/jmdna/software/annovar/humandb/ \
+    output {
-        -buildver hg19 -nastring . -vcfinput -remove -otherinfo \
+        String vcf = "${output_dir}/mutation/${name}.snp.indel.vcf"
-        -protocol refGene,avsnp150,cosmic91,clinvar_20220320,1000g2015aug_all,1000g2015aug_eas,esp6500siv2_all,exac03nontcga,gnomad_genome,dbnsfp35c \
+    }
-        -argument '-splicing_threshold 2 -hgvs',,,,,,,,, \
+}
-        -operation g,f,f,f,f,f,f,f,f,f \
+
-        --intronhgvs 50 \
+task mutation_calling_umi_control {
-        --outfile ${output_dir}/mutation/${name}.snp.indel.anno
+    String name
+    String bed
+    String ref
+    String output_dir
+    String tumor_rmdup_bam
+    String normal_rmdup_bam
+
+    command <<<
+        if [ ! -d ${output_dir}/mutation ];then
+        mkdir ${output_dir}/mutation
+        fi
+
+        # 对照样本
+        java -jar /dataseq/jmdna/software/VarDict-1.8.3/lib/VarDict-1.8.3.jar \
+        -G ${ref} \
+        -f 0.01 \
+        -N ${name} \
+        -b ${normal_rmdup_bam} \
+        -UN \
+        -Q 20 \
+        -m 3 \
+        -r 3 \
+        -th 10 \
+        -c 1 -S 2 -E 3 -g 4 ${bed} |/dataseq/jmdna/software/VarDict-1.8.3/bin/teststrandbias.R \
+        |/dataseq/jmdna/software/VarDict-1.8.3/bin/var2vcf_valid.pl -N ${name} -E -f 0.01 >${output_dir}/mutation/${name}_normal.snp.indel.vcf
+
+        # 实验样本
+        java -jar /dataseq/jmdna/software/VarDict-1.8.3/lib/VarDict-1.8.3.jar \
+        -G ${ref} \
+        -f 0.001 \
+        -N ${name} \
+        -b ${tumor_rmdup_bam} \
+        -UN -Q 20 -m 3 -r 3 -th 10 -c 1 -S 2 -E 3 -g 4 ${bed} \
+        | /dataseq/jmdna/software/VarDict-1.8.3/bin/teststrandbias.R \
+        | /dataseq/jmdna/software/VarDict-1.8.3/bin/var2vcf_valid.pl \
+        -N ${name} -E -f 0.001 > ${output_dir}/mutation/${name}.1r.snp.indel.vcf
+
+        #提取>=2条矫正的序列
+        func_fetch_bam.py ${output_dir}/alignment/${name}.rmdup.bam ${output_dir}/alignment/${name}.2r.rmdup.bam
+        samtools index ${output_dir}/alignment/${name}.2r.rmdup.bam
+
+        # 保证 1r call mut umi family 里面有2条reads
+        #2条矫正的call
+        java -jar /dataseq/jmdna/software/VarDict-1.8.3/lib/VarDict-1.8.3.jar -G ${ref} \
+        -f 0.0001 -N ${name}_2r -b ${output_dir}/alignment/${name}.2r.rmdup.bam \
+        -UN -Q 20 -m 3 -r 1 -th 10 -c 1 -S 2 -E 3 -g 4 ${bed} | /dataseq/jmdna/software/VarDict-1.8.3/bin/teststrandbias.R \
+        | /dataseq/jmdna/software/VarDict-1.8.3/bin/var2vcf_valid.pl -N ${name} -E -f 0.001 >${output_dir}/mutation/${name}.2r.snp.indel.vcf
+
+        #merge突变，以1条方式call的>0.01的突变+两条方式的对一条方式的低频区域（AF<0.01）进行矫正。
+        filter_snpindel_umi_1r_plus_2r.pl \
+        ${output_dir}/mutation/${name}.1r.snp.indel.vcf \
+        ${output_dir}/mutation/${name}.2r.snp.indel.vcf \
+        ${output_dir}/mutation/${name}.snp.indel.vcf
+
+        # 去除normal 中的突变位点
+        filter_snpindel_umi_subnormal.pl \
+        ${output_dir}/mutation/${name}_tumor.snp.indel.vcf \
+        ${output_dir}/mutation/${name}_normal.snp.indel.vcf \
+        ${output_dir}/mutation/${name}.snp.indel.vcf
 
     >>>
 
@@ -152,64 +189,59 @@ workflow call_mutation {
     String ref
     String bed
 
-    scatter(name in [tumor, normal]) {
+    # 双样本
-        if (defined(name)) {
+    if (defined(normal)) {
-            if (name==tumor) {
+        if (umi) {
-                if (umi) {
+            call mutation_calling_umi_control {
-                    call mutation_calling_umi as tumor_mutation_calling_umi {
+                input:
-                        input:
+                    name=tumor,
-                            name=name,
+                    output_dir=output_dir,
-                            output_dir=output_dir,
+                    ref=ref,
-                            ref=ref,
+                    bed=bed,
-                            bed=bed,
+                    tumor_rmdup_bam=tumor_rmdup_bam,
-                            rmdup_bam=tumor_rmdup_bam
+                    normal_rmdup_bam=normal_rmdup_bam
-                    }
-                }
-                if (!umi) {
-                    # 单样本模式，normal没有定义
-                    if (name==select_first([normal, tumor])) {
-                        call mutation_calling_tissue as tumor_mutation_calling_tissue {
-                            input:
-                                name=name,
-                                output_dir=output_dir,
-                                ref=ref,
-                                bed=bed,
-                                rmdup_bam=normal_rmdup_bam
-                        }
-                    }
-                    # 双样本模式，normal有定义
-                    if (name!=select_first([normal, tumor])) {
-                        call mutation_calling_tissue_control as tumor_mutation_calling_tissue_control {
-                            input:
-                                name=name,
-                                output_dir=output_dir,
-                                ref=ref,
-                                bed=bed,
-                                tumor_rmdup_bam=tumor_rmdup_bam,
-                                normal_rmdup_bam=normal_rmdup_bam
-                        }
-                    }
-                }
-            }
-            if (name==select_first([normal, 'None'])) {
-                if (umi) {
-                    call mutation_calling_tissue as normal_mutation_calling_tissue {
-                        input:
-                            name=name,
-                            output_dir=output_dir,
-                            ref=ref,
-                            bed=bed,
-                            rmdup_bam=normal_rmdup_bam
-                    }
-                }
 
             }
+        }
+        if (!umi) {
+            call mutation_calling_tissue_control {
+                input:
+                    name=tumor,
+                    output_dir=output_dir,
+                    ref=ref,
+                    bed=bed,
+                    tumor_rmdup_bam=tumor_rmdup_bam,
+                    normal_rmdup_bam=normal_rmdup_bam
 
+            }
+        }
+    }
+
+    # 单样本
+    if (!defined(normal)) {
+        if (umi) {
+            call mutation_calling_umi {
+                input:
+                    name=tumor,
+                    output_dir=output_dir,
+                    ref=ref,
+                    bed=bed,
+                    rmdup_bam=tumor_rmdup_bam
+            }
+        }
+        if (!umi) {
+            call mutation_calling_tissue {
+                input:
+                    name=tumor,
+                    output_dir=output_dir,
+                    ref=ref,
+                    bed=bed,
+                    rmdup_bam=normal_rmdup_bam
+            }
         }
     }
 
     output {
         String somatic_vcf = "${output_dir}/mutation/${tumor}.snp.indel.vcf"
-        String somatic_nc_vcf = "${output_dir}/mutation/${normal}.snp.indel.vcf"
     }
 }

wdl/task.wdl

@@ -6,130 +6,92 @@ task create_dir {
         if [ ! -d ${workdir} ];then
         mkdir -p ${workdir}/log
         fi
-
     >>>
 }
 
-task mutation_calling {
-    String name
-    String tumor_rmdupBam
-    String normal_rmdupBam
-    String outputDir
-    String bed
-
-    command <<<
-
-        if [ ! -d ${outputDir}/mutation ];then
-        mkdir ${outputDir}/mutation
-        fi
-
-        java -jar /dataseq/jmdna/software/VarDict-1.8.3/lib/VarDict-1.8.3.jar \
-        -G /dataseq/jmdna/database/genome/hg19/hg19.fa \
-        -f 0.01 \
-        -N ${name} \
-        -b "${tumor_rmdupBam}|${normal_rmdupBam}" \
-        -UN -Q 20 -m 3 -r 3 -th 20 -c 1 -S 2 -E 3 -g 4 ${bed} | \
-        /dataseq/jmdna/software/VarDict-1.8.3/bin/testsomatic.R | \
-        /dataseq/jmdna/software/VarDict-1.8.3/bin/var2vcf_paired.pl -N ${name} -f 0.01 \
-        > ${outputDir}/mutation/${name}_vardict.snp.indel.vcf
-
-        vep \
-        --input_file ${outputDir}/mutation/${name}_vardict.snp.indel.vcf \
-        --output_file ${outputDir}/mutation/${name}_vardict_vep.snp.indel.vcf \
-        --format vcf \
-        --vcf \
-        --symbol \
-        --terms SO \
-        --hgvs \--fasta /dataseq/jmdna/database/genome/hg19/hg19.fa \
-        --offline --cache --dir_cache /home/software/.vep \
-        --pick \
-        --force_overwrite
-
-    >>>
-
-    output {
-        String somatic_hc_vcf = "${outputDir}/mutation/${name}.snp.indel.Somatic.hc.vcf"
-        String germline_vcf="${outputDir}/mutation/${name}.snp.indel.Germline.vcf"
-        String loh_hc_vcf="${outputDir}/mutation/${name}.snp.indel.LOH.hc.vcf"
-    }
-
-}
-
 task annovar {
-    String name
+    String prefix
-    String outputDir
+    String output_dir
     String ref
-    String somatic_hc_vcf
+    String vcf
-    String germline_vcf
-    String loh_hc_vcf
-    String rmdupBam
 
     command <<<
 
-        if [ ! -d ${outputDir}/mutation ];then
+        if [ ! -d ${output_dir}/mutation ];then
-        mkdir ${outputDir}/mutation
+        mkdir ${output_dir}/mutation
         fi
 
         table_annovar.pl \
-        ${somatic_hc_vcf} \
+        ${vcf} \
         /dataseq/jmdna/software/annovar/humandb/ \
         -buildver hg19 -nastring . -vcfinput -remove -otherinfo \
         -protocol refGene,avsnp150,cosmic91,clinvar_20220320,1000g2015aug_all,1000g2015aug_eas,esp6500siv2_all,exac03nontcga,gnomad_genome,dbnsfp35c,cytoBand \
         -argument '-splicing_threshold 2 -hgvs',,,,,,,,,, \
         --intronhgvs 50 \
         -operation g,f,f,f,f,f,f,f,f,f,r \
-        --outfile ${outputDir}/mutation/${name}.snp.indel.Somatic.anno
+        --outfile ${output_dir}/mutation/${prefix}
-
-        table_annovar.pl \
-        ${germline_vcf} \
-        /dataseq/jmdna/software/annovar/humandb/ \
-        -buildver hg19 -nastring . -vcfinput -remove -otherinfo \
-        -protocol refGene,avsnp150,cosmic91,clinvar_20220320,1000g2015aug_all,1000g2015aug_eas,esp6500siv2_all,exac03nontcga,gnomad_genome,dbnsfp35c,cytoBand \
-        -argument '-splicing_threshold 2 -hgvs',,,,,,,,,, \
-        --intronhgvs 50 \
-        -operation g,f,f,f,f,f,f,f,f,f,r \
-        --outfile ${outputDir}/mutation/${name}.snp.indel.Germline.anno
-
-        table_annovar.pl \
-        ${loh_hc_vcf} \
-        /dataseq/jmdna/software/annovar/humandb/ \
-        -buildver hg19 -nastring . -vcfinput -remove -otherinfo \
-        -protocol refGene,avsnp150,cosmic91,clinvar_20220320,1000g2015aug_all,1000g2015aug_eas,esp6500siv2_all,exac03nontcga,gnomad_genome,dbnsfp35c,cytoBand \
-        -argument '-splicing_threshold 2 -hgvs',,,,,,,,,, \
-        --intronhgvs 50 \
-        -operation g,f,f,f,f,f,f,f,f,f,r \
-        --outfile ${outputDir}/mutation/${name}.snp.indel.LOH.anno
-
-        java -jar /dataseq/jmdna/software/GenomeAnalysisTK.3.7.jar -T VariantAnnotator \
-        -R ${ref} \
-        -I ${rmdupBam} \
-        -V ${somatic_hc_vcf} \
-        -o ${outputDir}/mutation/${name}.TandemRepeatAnnotator.vcf \
-        --annotation TandemRepeatAnnotator
-
-        grep -v "^##" ${outputDir}/mutation/${name}.TandemRepeatAnnotator.vcf \
-        |cut -f8| paste ${outputDir}/mutation/${name}.snp.indel.Somatic.anno.hg19_multianno.txt  - \
-        > ${outputDir}/mutation/${name}.snp.indel.Somatic.annoall.hg19_multianno.txt
 
     >>>
     output {
-        String somatic_anno = "${outputDir}/mutation/${name}.snp.indel.Somatic.anno.hg19_multianno.txt"
+        String anno = "${output_dir}/mutation/${prefix}.hg19_multianno.txt"
-        String germline_anno = "${outputDir}/mutation/${name}.snp.indel.Germline.anno.hg19_multianno.txt"
+    }
-        String somatic_all_anno = "${outputDir}/mutation/${name}.snp.indel.Somatic.annoall.hg19_multianno.txt"
+}
+
+task dealwithsnvindel {
+    String name
+    String anno
+    String project
+    String output_dir
+    String umi
+    String tumor_rmdup_bam
+
+    command <<<
+
+        if [ ! -d ${output_dir}/mutation ];then
+        mkdir ${output_dir}/mutation
+        fi
+
+        if ${umi} ;then
+        filter_snpindel_common.pl \
+        ${anno} \
+        ${project} \
+        c \
+        ${output_dir}/mutation/${name}.snp.indel.Somatic.anno.hg19_multianno_filtered_pre.txt \
+        ${output_dir}/mutation/${name}.snp.indel.Germline.anno.hg19_multianno_filtered.txt \
+        ${output_dir}/mutation/${name}.snp.indel.anno.hg19_multianno_tag.txt
+
+        filter_snpindel_umi_correct_f1r1.py \
+        ${output_dir}/mutation/${name}.snp.indel.Somatic.anno.hg19_multianno_filtered_pre.txt \
+        ${tumor_rmdup_bam} \
+        ${output_dir}/mutation/${name}.snp.indel.Somatic.anno.hg19_multianno_filtered.txt
+
+        else
+        filter_snpindel_common.pl \
+        ${anno} \
+        ${project} \
+        t \
+        ${output_dir}/mutation/${name}.snp.indel.Somatic.anno.hg19_multianno_filtered.txt \
+        ${output_dir}/mutation/${name}.snp.indel.Germline.anno.hg19_multianno_filtered.txt \
+        ${output_dir}/mutation/${name}.snp.indel.anno.hg19_multianno_tag.txt
+
+    >>>
+    output {
+        String snvindel_filtered= "${output_dir}/mutation/${name}.snp.indel.Somatic.anno.hg19_multianno_filtered.txt"
+        String germline_filtered = "${output_dir}/mutation/${name}.snp.indel.Germline.anno.hg19_multianno_filtered.txt"
     }
 }
 
 task tmb {
     String codesDir
     String name
-    String outputDir
+    String output_dir
     String somatic_anno
 
     command <<<
-        perl ${codesDir}/tmb.pl ${outputDir} ${name}
+        perl ${codesDir}/tmb.pl ${output_dir} ${name}
     >>>
     output {
-        String tmb="${outputDir}/mutation/${name}.tmb.txt"
+        String tmb="${output_dir}/mutation/${name}.tmb.txt"
     }
 }
 
@@ -137,7 +99,7 @@ task fusion {
     String name
     String ref
     String codesDir
-    String outputDir
+    String output_dir
     String rmdupBam
     String cancer
     String project
@@ -145,48 +107,48 @@ task fusion {
 
     command <<<
 
-        if [ ! -d ${outputDir}/fusion ];then
+        if [ ! -d ${output_dir}/fusion ];then
-        mkdir ${outputDir}/fusion
+        mkdir ${output_dir}/fusion
         fi
 
         # Extract the discordant paired-end alignments.
-        samtools view -b -F 1294 ${rmdupBam} > ${outputDir}/fusion/${name}.discordants.bam
+        samtools view -b -F 1294 ${rmdupBam} > ${output_dir}/fusion/${name}.discordants.bam
 
         # Extract the split-read alignments
         samtools view -h ${rmdupBam} \
         | /dataseq/jmdna/software/lumpy-sv/scripts/extractSplitReads_BwaMem -i stdin \
         | samtools view -Sb - \
-        > ${outputDir}/fusion/${name}.splitters.bam
+        > ${output_dir}/fusion/${name}.splitters.bam
 
         lumpyexpress \
         -B ${rmdupBam} \
-        -S ${outputDir}/fusion/${name}.splitters.bam \
+        -S ${output_dir}/fusion/${name}.splitters.bam \
-        -D ${outputDir}/fusion/${name}.discordants.bam \
+        -D ${output_dir}/fusion/${name}.discordants.bam \
-        -o ${outputDir}/fusion/${name}.fusion.vcf
+        -o ${output_dir}/fusion/${name}.fusion.vcf
 
-        perl ${codesDir}/fusion.filter.pl ${outputDir}/fusion/${name}.fusion.vcf ${outputDir}/fusion/${name}.fusion.filter.vcf
+        perl ${codesDir}/fusion.filter.pl ${output_dir}/fusion/${name}.fusion.vcf ${output_dir}/fusion/${name}.fusion.filter.vcf
 
         svtyper \
         -B ${rmdupBam} \
-        -i ${outputDir}/fusion/${name}.fusion.filter.vcf \
+        -i ${output_dir}/fusion/${name}.fusion.filter.vcf \
         -T ${ref} \
-        -o ${outputDir}/fusion/${name}.fusion.gt.vcf
+        -o ${output_dir}/fusion/${name}.fusion.gt.vcf
 
         table_annovar.pl \
-        ${outputDir}/fusion/${name}.fusion.gt.vcf \
+        ${output_dir}/fusion/${name}.fusion.gt.vcf \
         /dataseq/jmdna/software/annovar/humandb/ \
         -buildver hg19 -nastring . -vcfinput -remove -otherinfo \
         -protocol refGene \
         -operation g \
-        --outfile ${outputDir}/fusion/${name}.fusion
+        --outfile ${output_dir}/fusion/${name}.fusion
 
-        perl ${codesDir}/fusion.reanno.pl ${tumor_bamdst_depth} ${outputDir} ${name}
+        perl ${codesDir}/fusion.reanno.pl ${tumor_bamdst_depth} ${output_dir} ${name}
-        perl /home/jm001/test_duantao/database_update/codes/682/fusion_targetTherapy.pl ${codesDir} ${name} ${outputDir} ${project} ${cancer}
+        perl /home/jm001/test_duantao/database_update/codes/682/fusion_targetTherapy.pl ${codesDir} ${name} ${output_dir} ${project} ${cancer}
 
     >>>
 
     output {
-        String fusion = "${outputDir}/fusion/${name}.fusion.pos.txt"
+        String fusion = "${output_dir}/fusion/${name}.fusion.pos.txt"
     }
 }
 
@@ -195,7 +157,7 @@ task tumor_content {
     String tumor_pileup
     String normal_pileup
     String ref
-    String outputDir
+    String output_dir
     String codesDir
     String gc_wiggle = "/dataseq/jmdna/codes/pancancer_controlsample/hg19.gc200Base.txt.gz"
 
@@ -206,16 +168,16 @@ task tumor_content {
         -F ${ref} \
         -n ${normal_pileup} \
         -t ${tumor_pileup} \
-        | gzip > ${outputDir}/qc/target_${name}.200base.seqz.gz
+        | gzip > ${output_dir}/qc/target_${name}.200base.seqz.gz
 
-        sequenza-utils seqz_binning -w 200 -s ${outputDir}/qc/target_${name}.200base.seqz.gz \
+        sequenza-utils seqz_binning -w 200 -s ${output_dir}/qc/target_${name}.200base.seqz.gz \
-        | gzip  > ${outputDir}/qc/target_${name}.200base.small.seqz.gz
+        | gzip  > ${output_dir}/qc/target_${name}.200base.small.seqz.gz
 
-        Rscript ${codesDir}/sequenza.R ${name} ${outputDir}/qc/target_${name}.200base.small.seqz.gz ${outputDir}/qc/sequenza || echo "sequenza failed!"
+        Rscript ${codesDir}/sequenza.R ${name} ${output_dir}/qc/target_${name}.200base.small.seqz.gz ${output_dir}/qc/sequenza || echo "sequenza failed!"
 
     >>>
     output {
-        String purity = "${outputDir}/qc/sequenza/${name}_CP_contours.pdf"
+        String purity = "${output_dir}/qc/sequenza/${name}_CP_contours.pdf"
     }
 
 }
@@ -228,7 +190,7 @@ task cnvkit {
     String normal_rmdupBam
     String ref
     String bed
-    String outputDir
+    String output_dir
     String cancer
     String codesDir
     String project
@@ -237,8 +199,8 @@ task cnvkit {
 
     command <<<
 
-        if [ ! -d ${outputDir}/cnvkit ];then
+        if [ ! -d ${output_dir}/cnvkit ];then
-        mkdir ${outputDir}/cnvkit
+        mkdir ${output_dir}/cnvkit
         fi
 
         cnvkit.py batch \
@@ -247,149 +209,128 @@ task cnvkit {
         --targets ${bed} \
         --fasta ${ref} \
         --access ${accessBed} \
-        --output-reference ${outputDir}/cnvkit/${normal}_reference.cnn \
+        --output-reference ${output_dir}/cnvkit/${normal}_reference.cnn \
         --annotate ${annotateGene} \
-        --drop-low-coverage --scatter --output-dir ${outputDir}/cnvkit
+        --drop-low-coverage --scatter --output-dir ${output_dir}/cnvkit
 
         cnvkit.py scatter \
-        ${outputDir}/cnvkit/${tumor}.rmdup.cnr -s ${outputDir}/cnvkit/${tumor}.rmdup.cns \
+        ${output_dir}/cnvkit/${tumor}.rmdup.cnr -s ${output_dir}/cnvkit/${tumor}.rmdup.cns \
         --y-max 3 --y-min -3 \
         --title ${tumor}.cns \
-        -o ${outputDir}/cnvkit/${tumor}.cnv.png
+        -o ${output_dir}/cnvkit/${tumor}.cnv.png
 
-        perl ${codesDir}/log2_cn.pl ${outputDir}/cnvkit/${tumor}.rmdup.cns ${outputDir}/cnvkit/${tumor}.rmdup.cns.cn
+        perl ${codesDir}/log2_cn.pl ${output_dir}/cnvkit/${tumor}.rmdup.cns ${output_dir}/cnvkit/${tumor}.rmdup.cns.cn
-        perl /home/jm001/test_duantao/database_update/codes/682/cnv_targetTherapy.pl ${codesDir} ${tumor} ${outputDir} ${project} ${cancer}
+        perl /home/jm001/test_duantao/database_update/codes/682/cnv_targetTherapy.pl ${codesDir} ${tumor} ${output_dir} ${project} ${cancer}
     >>>
 
     output {
-        String cns = "${outputDir}/cnvkit/${tumor}.rmdup.cns"
+        String cns = "${output_dir}/cnvkit/${tumor}.rmdup.cns"
-        String png = "${outputDir}/cnvkit/${tumor}.cnv.png"
+        String png = "${output_dir}/cnvkit/${tumor}.cnv.png"
     }
 
 }
 
 task chemo {
     String codesDir
-    String outputDir
+    String output_dir
     String project
     String normal
     String rmdupBam
     command <<<
 
-        if [ ! -d ${outputDir}/chemo ];then
+        if [ ! -d ${output_dir}/chemo ];then
-        mkdir ${outputDir}/chemo
+        mkdir ${output_dir}/chemo
         fi
 
-        ${codesDir}/chemo/chemo_panel.py -p ${project} -o ${outputDir} --n ${normal}
+        ${codesDir}/chemo/chemo_panel.py -p ${project} -o ${output_dir} --n ${normal}
     >>>
 }
 
 task msi {
     String bed
     String name
-    String outputDir
+    String output_dir
     String tumor_rmdupBam
     String normal_rmdupBam
 
     command <<<
-        if [ ! -d ${outputDir}/msi ];then
+        if [ ! -d ${output_dir}/msi ];then
-        mkdir ${outputDir}/msi
+        mkdir ${output_dir}/msi
         fi
 
         msisensor2 msi -d /dataseq/jmdna/software/msisensor2/hg19.microsatellites.list \
         -n ${normal_rmdupBam} \
         -t ${tumor_rmdupBam} \
-        -e ${bed} -b 10 -o ${outputDir}/msi/${name}.msi
+        -e ${bed} -b 10 -o ${output_dir}/msi/${name}.msi
 
     >>>
     output {
-        String target="${outputDir}/MSI/${name}.msi"
+        String target="${output_dir}/MSI/${name}.msi"
     }
 }
 
 task hla {
     String inputDir
-    String outputDir
+    String output_dir
     String normal
 
     command <<<
-        if [ ! -d ${outputDir}/neoantigen ];then
+        if [ ! -d ${output_dir}/neoantigen ];then
-        mkdir -p ${outputDir}/neoantigen/HLA
+        mkdir -p ${output_dir}/neoantigen/HLA
         fi
 
         razers3 -tc 10 -i 95 -m 1 -dr 0 \
-        -o ${outputDir}/neoantigen/HLA/fished_1.bam /dataseq/jmdna/software/OptiType-1.3.5/data/hla_reference_dna.fasta \
+        -o ${output_dir}/neoantigen/HLA/fished_1.bam /dataseq/jmdna/software/OptiType-1.3.5/data/hla_reference_dna.fasta \
         ${inputDir}/*_${normal}_*1.fq.gz
 
-        samtools bam2fq ${outputDir}/neoantigen/HLA/fished_1.bam > ${outputDir}/neoantigen/HLA/${normal}_1_fished.fastq
+        samtools bam2fq ${output_dir}/neoantigen/HLA/fished_1.bam > ${output_dir}/neoantigen/HLA/${normal}_1_fished.fastq
-        rm ${outputDir}/neoantigen/HLA/fished_1.bam
+        rm ${output_dir}/neoantigen/HLA/fished_1.bam
 
         razers3 -tc 10 -i 95 -m 1 -dr 0 \
-        -o ${outputDir}/neoantigen/HLA/fished_2.bam /dataseq/jmdna/software/OptiType-1.3.5/data/hla_reference_dna.fasta \
+        -o ${output_dir}/neoantigen/HLA/fished_2.bam /dataseq/jmdna/software/OptiType-1.3.5/data/hla_reference_dna.fasta \
         ${inputDir}/*_${normal}_*2.fq.gz
 
-        samtools bam2fq ${outputDir}/neoantigen/HLA/fished_2.bam > ${outputDir}/neoantigen/HLA/${normal}_2_fished.fastq
+        samtools bam2fq ${output_dir}/neoantigen/HLA/fished_2.bam > ${output_dir}/neoantigen/HLA/${normal}_2_fished.fastq
-        rm ${outputDir}/neoantigen/HLA/fished_2.bam
+        rm ${output_dir}/neoantigen/HLA/fished_2.bam
 
         /dataseq/jmdna/software/OptiType-1.3.5/OptiTypePipeline.py \
-        -i ${outputDir}/neoantigen/HLA/${normal}_1_fished.fastq  ${outputDir}/neoantigen/HLA/${normal}_2_fished.fastq \
+        -i ${output_dir}/neoantigen/HLA/${normal}_1_fished.fastq  ${output_dir}/neoantigen/HLA/${normal}_2_fished.fastq \
-        --dna -v --prefix ${normal} -o ${outputDir}/neoantigen/HLA/
+        --dna -v --prefix ${normal} -o ${output_dir}/neoantigen/HLA/
 
     >>>
     output {
-        String hla = "${outputDir}/neoantigen/HLA/${normal}_result.tsv"
+        String hla = "${output_dir}/neoantigen/HLA/${normal}_result.tsv"
     }
 }
 
 task neoantigen {
     String codesDir
-    String outputDir
+    String output_dir
     String name
     String normal
     String somatic_hc_vcf
     String hla
     command <<<
-        sh /home/jm001/test_duantao/database_update/test_project/20230814_test/predict_neoantigen.sh ${outputDir} ${name} ${name} ${codesDir}
+        sh /home/jm001/test_duantao/database_update/test_project/20230814_test/predict_neoantigen.sh ${output_dir} ${name} ${name} ${codesDir}
     >>>
     output {
-        String neoantigen = "${outputDir}/neoantigen/MHC_Class_I/${name}.all_epitopes.netchop.txt"
+        String neoantigen = "${output_dir}/neoantigen/MHC_Class_I/${name}.all_epitopes.netchop.txt"
-    }
-}
-
-task dealwithsnvindel {
-    String codesDir
-    String name
-    String somatic_all_anno
-    String germline_anno
-    String project
-    String outputDir
-    String cancer
-
-    command <<<
-        perl ${codesDir}/pick_variant.pl ${outputDir} ${name}
-        perl ${codesDir}/pick_mut_splice_promoter.pl ${codesDir} ${name} ${outputDir} ${project}
-        perl /home/jm001/test_duantao/database_update/codes/682/targetTherapy.pl ${name} ${outputDir} ${project} ${cancer}
-        perl /home/jm001/test_duantao/database_update/codes/682/germline_targetTherapy.pl ${name} ${outputDir} ${project} ${cancer}
-    >>>
-    output {
-        String snvindel_filtered= "${outputDir}/mutation/${name}.snp.indel.Somatic.annoall.hg19_multianno_filtered.txt"
-        String germline_filtered = "${outputDir}/mutation/${name}.snp.indel.Germline.anno.hg19_multianno_filtered.txt"
     }
 }
 
 task hereditary {
     String codesDir
     String name
-    String outputDir
+    String output_dir
     String project
     String germline_filtered
     command <<<
 
-        ${codesDir}/hereditary/hereditary.py -p ${project} -o ${outputDir} --n ${name}
+        ${codesDir}/hereditary/hereditary.py -p ${project} -o ${output_dir} --n ${name}
     >>>
 
     output {
-        String hereditary_pre = "${outputDir}/hereditary/${name}.hereditary.pre.txt"
+        String hereditary_pre = "${output_dir}/hereditary/${name}.hereditary.pre.txt"
     }
 }
 
@@ -398,101 +339,101 @@ task conpair {
     String name
     String tumor_rmdupBam
     String normal_rmdupBam
-    String outputDir
+    String output_dir
     String ref
 
     command <<<
 
-        if [ ! -d ${outputDir}/conpair ];then
+        if [ ! -d ${output_dir}/conpair ];then
-        mkdir -p ${outputDir}/conpair
+        mkdir -p ${output_dir}/conpair
         fi
 
         python3 /dataseq/jmdna/software/Conpair-master/scripts/run_gatk_pileup_for_sample.py \
         -M /dataseq/jmdna/software/Conpair-master/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.bed \
         -B ${tumor_rmdupBam} \
-        -O ${outputDir}/conpair/${name}.tumor.gatk.mpileup \
+        -O ${output_dir}/conpair/${name}.tumor.gatk.mpileup \
         -R ${ref} \
         -G /dataseq/jmdna/software/GenomeAnalysisTK.3.7.jar
 
         python3 /dataseq/jmdna/software/Conpair-master/scripts/run_gatk_pileup_for_sample.py \
         -M /dataseq/jmdna/software/Conpair-master/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.bed \
         -B ${normal_rmdupBam} \
-        -O ${outputDir}/conpair/${name}.normal.gatk.mpileup \
+        -O ${output_dir}/conpair/${name}.normal.gatk.mpileup \
         -R ${ref} \
         -G /dataseq/jmdna/software/GenomeAnalysisTK.3.7.jar
 
-        sed -i 's/^chr//g' ${outputDir}/conpair/${name}.tumor.gatk.mpileup
+        sed -i 's/^chr//g' ${output_dir}/conpair/${name}.tumor.gatk.mpileup
-        sed -i 's/^chr//g' ${outputDir}/conpair/${name}.normal.gatk.mpileup
+        sed -i 's/^chr//g' ${output_dir}/conpair/${name}.normal.gatk.mpileup
 
         python3 /dataseq/jmdna/software/Conpair-master/scripts/verify_concordance.py \
         -H \
-        -T ${outputDir}/conpair/${name}.tumor.gatk.mpileup \
+        -T ${output_dir}/conpair/${name}.tumor.gatk.mpileup \
-        -N ${outputDir}/conpair/${name}.normal.gatk.mpileup \
+        -N ${output_dir}/conpair/${name}.normal.gatk.mpileup \
-        -O ${outputDir}/conpair/${name}_concordance.txt
+        -O ${output_dir}/conpair/${name}_concordance.txt
 
         python3 /dataseq/jmdna/software/Conpair-master/scripts/estimate_tumor_normal_contamination.py \
-        -T ${outputDir}/conpair/${name}.tumor.gatk.mpileup \
+        -T ${output_dir}/conpair/${name}.tumor.gatk.mpileup \
-        -N ${outputDir}/conpair/${name}.normal.gatk.mpileup \
+        -N ${output_dir}/conpair/${name}.normal.gatk.mpileup \
-        -O ${outputDir}/conpair/${name}_contamination.txt
+        -O ${output_dir}/conpair/${name}_contamination.txt
 
     >>>
     output {
-        String concordance = "${outputDir}/conpair/${name}_concordance.txt"
+        String concordance = "${output_dir}/conpair/${name}_concordance.txt"
-        String contamination = "${outputDir}/conpair/${name}_contamination.txt"
+        String contamination = "${output_dir}/conpair/${name}_contamination.txt"
     }
 }
 
 task mmr {
     String codesDir
     String name
-    String outputDir
+    String output_dir
     String germline_filtered
     command <<<
-        if [ ! -d ${outputDir}/MMR ];then
+        if [ ! -d ${output_dir}/MMR ];then
-        mkdir -p ${outputDir}/MMR
+        mkdir -p ${output_dir}/MMR
         fi
-        perl ${codesDir}/mmr_controlsample.pl ${outputDir} ${name}
+        perl ${codesDir}/mmr_controlsample.pl ${output_dir} ${name}
     >>>
     output {
-        String mmr = "${outputDir}/MMR/${name}_mmr.txt"
+        String mmr = "${output_dir}/MMR/${name}_mmr.txt"
     }
 }
 
 task hrr {
     String codesDir
     String name
-    String outputDir
+    String output_dir
     String germline_filtered
     command <<<
-        if [ ! -d ${outputDir}/HRR ];then
+        if [ ! -d ${output_dir}/HRR ];then
-        mkdir -p ${outputDir}/HRR
+        mkdir -p ${output_dir}/HRR
         fi
-        perl ${codesDir}/hrr_controlsample_tissue.pl ${outputDir} ${name}
+        perl ${codesDir}/hrr_controlsample_tissue.pl ${output_dir} ${name}
     >>>
     output {
-        String hrr = "${outputDir}/HRR/${name}_hrr.txt"
+        String hrr = "${output_dir}/HRR/${name}_hrr.txt"
     }
 }
 
 task hotspot {
     String name
-    String outputDir
+    String output_dir
     String ref
     String rmdupBam
     String codesDir
     command <<<
-        if [ ! -d ${outputDir}/mutation/hotspot/ ];then
+        if [ ! -d ${output_dir}/mutation/hotspot/ ];then
-        mkdir -p ${outputDir}/mutation/hotspot/
+        mkdir -p ${output_dir}/mutation/hotspot/
         fi
 
         samtools mpileup -Bq 20 -Q 20  \
         -f ${ref} \
         -l ${codesDir}/hotspot.bed \
-        -o ${outputDir}/mutation/hotspot/${name}.hotspot.pileup \
+        -o ${output_dir}/mutation/hotspot/${name}.hotspot.pileup \
         ${rmdupBam}
 
         java -jar $VARSCAN mpileup2cns \
-        ${outputDir}/mutation/hotspot/${name}.hotspot.pileup \
+        ${output_dir}/mutation/hotspot/${name}.hotspot.pileup \
         --min-var-freq 0.005 \
         --min-avg-qual 20 \
         --output-vcf 1 \
@@ -500,10 +441,10 @@ task hotspot {
         --p-value 0.99 \
         --min-reads2 2 \
         --strand-filter 0 \
-        > ${outputDir}/mutation/hotspot/${name}.hotspot.L.snp.indel.vcf
+        > ${output_dir}/mutation/hotspot/${name}.hotspot.L.snp.indel.vcf
 
         java -jar $VARSCAN mpileup2cns \
-        ${outputDir}/mutation/hotspot/${name}.hotspot.pileup \
+        ${output_dir}/mutation/hotspot/${name}.hotspot.pileup \
         --min-var-freq 0.01 \
         --min-avg-qual 20 \
         --output-vcf 1 \
@@ -511,32 +452,32 @@ task hotspot {
         --p-value 0.05 \
         --min-reads2 3 \
         --strand-filter 1 \
-        > ${outputDir}/mutation/hotspot/${name}.hotspot.H.snp.indel.vcf
+        > ${output_dir}/mutation/hotspot/${name}.hotspot.H.snp.indel.vcf
 
-        perl ${codesDir}/hotspot.hvl.pl ${outputDir} ${name}
+        perl ${codesDir}/hotspot.hvl.pl ${output_dir} ${name}
 
-        if [ -e "${outputDir}/mutation/hotspot/${name}.hotspot.snp.indel.vcf" ]; then
+        if [ -e "${output_dir}/mutation/hotspot/${name}.hotspot.snp.indel.vcf" ]; then
         table_annovar.pl \
-        ${outputDir}/mutation/hotspot/${name}.hotspot.snp.indel.vcf \
+        ${output_dir}/mutation/hotspot/${name}.hotspot.snp.indel.vcf \
         /dataseq/jmdna/software/annovar/humandb/ \
         -buildver hg19 -nastring . -vcfinput -remove -otherinfo \
         -protocol refGene \
         -argument '-hgvs' \
         -operation g \
-        --outfile ${outputDir}/mutation/hotspot/${name}.hotspot.snp.indel.anno
+        --outfile ${output_dir}/mutation/hotspot/${name}.hotspot.snp.indel.anno
-        perl ${codesDir}/hotspot.filter.pl ${outputDir} ${name}
+        perl ${codesDir}/hotspot.filter.pl ${output_dir} ${name}
         fi
 
     >>>
     output {
-        String  hotspot = "${outputDir}/mutation/hotspot/${name}.hotspot.H.snp.indel.vcf"
+        String  hotspot = "${output_dir}/mutation/hotspot/${name}.hotspot.H.snp.indel.vcf"
     }
 }
 
 task auto_report {
     String cancer
     String codesDir
-    String outputDir
+    String output_dir
 
     String normal
     String tumor
@@ -554,28 +495,28 @@ task auto_report {
 
     command <<<
 
-        if [ ! -d ${outputDir}/report ];then
+        if [ ! -d ${output_dir}/report ];then
-        mkdir -p ${outputDir}/report
+        mkdir -p ${output_dir}/report
         fi
 
-        perl /home/jm001/test_duantao/database_update/codes/682/indication.pl ${outputDir} ${cancer}
+        perl /home/jm001/test_duantao/database_update/codes/682/indication.pl ${output_dir} ${cancer}
-        python3 ${codesDir}/drug_dedup.py ${outputDir} ${tumor}
+        python3 ${codesDir}/drug_dedup.py ${output_dir} ${tumor}
-        perl ${codesDir}/file_format_change.pl ${outputDir} ${tumor}
+        perl ${codesDir}/file_format_change.pl ${output_dir} ${tumor}
-        python3 ${codesDir}/report_template/682gene_tissue_control_report.py ${outputDir} ${tumor} ${normal} ${cancer}
+        python3 ${codesDir}/report_template/682gene_tissue_control_report.py ${output_dir} ${tumor} ${normal} ${cancer}
 
-        ln -s  ${cnv_cns} ${outputDir}/report/
+        ln -s  ${cnv_cns} ${output_dir}/report/
-        ln -s  ${cnv_png} ${outputDir}/report/
+        ln -s  ${cnv_png} ${output_dir}/report/
 
-        ln -s  ${fusion_pos} ${outputDir}/report/
+        ln -s  ${fusion_pos} ${output_dir}/report/
-        ln -s ${snvindel_filtered} ${outputDir}/report/
+        ln -s ${snvindel_filtered} ${output_dir}/report/
 
-        ln -s ${tmb} ${outputDir}/report/
+        ln -s ${tmb} ${output_dir}/report/
 
-        ln -s ${mmr} ${outputDir}/report/
+        ln -s ${mmr} ${output_dir}/report/
 
-        ln -s ${hrr} ${outputDir}/report/
+        ln -s ${hrr} ${output_dir}/report/
 
-        ln -s ${hereditary_pre} ${outputDir}/report/
+        ln -s ${hereditary_pre} ${output_dir}/report/
 
     >>>
 }